June 15, 2024

M-Dudes

Your Partner in The Digital Era

Programming inactive RNA-binding small molecules into bioactive degraders

General methods

All DNA templates and primers were purchased from Integrated DNA Technologies (IDT) and used without further purification. Chemically synthesized RNA oligonucleotides and oligonucleotide competitors were obtained from Dharmacon and deprotected according to the manufacturer’s recommended protocol. After deprotection, the RNAs were desalted using a PD-10 Sephadex column (GE Healthcare) according to the manufacturer’s protocol. All oligonucleotide concentrations were determined by their absorption at 260 nm at 90 °C and the corresponding extinction coefficient provided by the manufacturer. The compound MZ1 was purchased from MedChemExpress.

All autoradiographical images and ethidium bromide staining images were obtained on the Typhoon FLA9500 variable mode imager (GE Healthcare). The Western blot images were obtained using the AFP Imaging Mini-Medical/90 system. These images were quantified using Image J (v.1.8.0_112). All numerical calculations were performed using Microsoft Excel (Office 365) and GraphPad 8 (v.8.0.2).

Statistics and reproducibility

Experimental results shown as representative blots or gel autoradiograms were successfully replicated two or more times to ensure the reproducibility of the reported findings. The number and type of replicates as well as statistical significance are provided in the figure legends.

In vitro Chem-CLIP binding site mapping

Pre-miR-155 RNA (500 pmol) was folded in 1× folding buffer (FB; 20 mM HEPES, pH 7.5, 150 mM NaCl, and 5 mM KCl) by heating at 95 °C for 30 s followed by cooling on ice for 5 min. Next, 50 nM of pre-miR-155-Chem-CLIP was added to the folded pre-miR-155, and the sample was incubated at 37 °C overnight. Cross-linked pre-miR-155 was captured on Dynabeads and eluted according to the manufacturer’s protocol. Reverse transcription of the pulled-down RNA was performed using a gene-specific primer (5′-CAGACGTGCTCTTCCGATCTCTGTTAATGCTAATAT-3′) and Superscript III (SSIII) according to the manufacturer’s protocol. The RT reaction was processed using RNAClean XP (Beckman Coulter) according to the manufacturer’s protocol. A ssDNA adaptor (5′phosphate-NNNAGATCGGAAGAGCGTCGTGTAG-3C spacer) was ligated to the purified RT product using T4 RNA ligase I (New England BioLabs (NEB)) and then RNA Clean XP was added according to the manufacturer’s protocol. The ligated cDNA was amplified using Phusion polymerase (NEB) using the following primers: 5′-CTACACGACGCTCTTCCGATCT-3′ and 5′-CAGACGTGCTCTTCCGAT-3′. The PCR reaction was purified with a denaturing 10% acrylamide gel and ethanol precipitation. The purified PCR product was cloned into NEB’s pminiT 2.0 vector according to the manufacturer’s protocol and sequenced by Eton Biosciences.

Tissue culture

MDA-MB-231 triple-negative breast cancer cells (HTB-26; ATCC) were cultured in RPMI medium with l-glutamine and 25 mM HEPES (Corning; 10-041) supplemented with 10% (v/v) fetal bovine serum (FBS; Sigma-Aldrich; F2442) and 1× penicillin–streptomycin solution (Gibco; 15140122).

MCF-10a breast epithelial cells (CRL-10317; ATCC) were cultured in DMEM/F12 50/50 medium with l-glutamine and 15 mM HEPES (Corning; 10-092-CV) containing 20% (v/v) FBS, 1× antibiotic–antimycotic solution (Corning; 30-004-CI), 20 ng ml−1 human epidermal growth factor (Pepro Tech; GMP100-15), 100 μg ml−1 insulin and 0.5 mg ml−1 hydrocortisone (Sigma-Aldrich; H0888).

CFPAC1 ductal adenocarcinoma epithelial cells (CRL-1918; ATCC) were cultured in 1× IMDM medium (Gibco, 12440053) with 10% (v/v) FBS and 1× antibiotic–antimycotic solution.

HUVECs (Lonza, CC-2517) were cultured in EGM prepared using the EGM-2 bullet kit (Lonza; CC-3162) according to the manufacturer’s protocol.

HeLa cells (CCL-2, ATCC) and HEK293T cells (CRL-3216, ATCC) were cultured in 1× DMEM medium with 4.5 g l−1 glucose (Gibco, 11965092) supplemented with 2 mM glutamine or 1% Glutagro (Corning; 25-015-CI), 1× penicillin–streptomycin solution and 10% (v/v) FBS.

MIA PaCa-2 pancreatic adenocarcinoma cells (CRL-1420; ATCC) and CRISPR lines derived from MIA PaCa-2 pancreatic adenocarcinoma cells (Supplementary Fig. 6) were cultured in 1× DMEM medium with 4.5 g l−1 glucose supplemented with 1% Glutagro, 1× penicillin–streptomycin solution and 10% (v/v) FBS.

Namalwa (CRL-1432) and Raji (CCL-86) Burkitt lymphoma cells, and HL-60 (CCL-240) myeloid leukaemia cells, were obtained from ATCC and were cultured in RPMI medium with l-glutamine and 25 mM HEPES supplemented with 10% (v/v) FBS and 1× penicillin–streptomycin solution.

The passage number for all cell lines was <20, except for HUVECs (<6) and HeLa cells (<30). All cells were checked to be free of mycoplasma contamination before conducting experiments using a PCR Mycoplasma Test Kit (PromoCell).

Forced expression of pre-miR-155 in MCF-10a cells

The plasmid to overexpress wild-type pre-miR-155 were purchased from Genecopoeia (HmiR0358) and the mutant plasmids were custom synthesized by GeneScript. MCF-10a cells were seeded at around 70% confluency in 60 mm dishes and transfected with a plasmid (2 µg per dish) encoding either wild-type or mutant pre-miR-155 (Extended Data Fig. 9a) using Lipofectamine 3000 (Invitrogen) according to the manufacture’s protocol. The cells were incubated in the transfection cocktail for 6 h followed by changing to fresh growth medium and incubated for an additional 16 h. Cells were then trypsinized and seeded for biological experiments as described in the following sections.

Cellular Chem-CLIP and competitive Chem-CLIP analysis of pre-miR-155, MYC and JUN

General protocol for cellular Chem-CLIP

After compound treatment as specified for each target below, cells were washed once with 1× DPBS and irradiated by ultraviolet light for 15 min. Total RNA was extracted using the Zymo Quick-RNA MiniPrep Kit according to the manufacturer’s protocol. The input RNA (10 µg) was incubated with azide-modified agarose beads (Click Chemistry Tools) according to the manufacturer’s protocol, followed by adding a total of 45 µl reaction solution with 1:1:1 of ascorbic acid (250 mM), CuSO4 (10 mM), THPTA (tris-hydroxypropyltriazolylmethylamine; 50 mM). After incubating at 37 °C for 2 h, the beads were washed six times with washing buffer (10 mM Tris-HCl, pH 7, 4 M NaCl, 1 mM EDTA and 0.1% Tween-20) and resuspended in 100 µl release solution containing 200 mM TCEP and 400 mM K2CO3. The mixture was incubated at 37 °C for 30 min, followed by adding 50 µl of 800 mM iodoacetamide and incubating for another 30 min. The supernatant containing RNA was carefully transferred to a clean tube and purified by RNAClean XP beads (Beckman Coulter) according to the manufacturer’s protocol. The purified RNA was analysed using RT–qPCR as described in the ‘RT–qPCR analysis of mRNAs and pri-, pre- and mature miRNA levels’ section.

Pre-miR-155 Chem-CLIP

MDA-MB-231 cells, grown to about 80% confluency in 100-mm-diameter dishes, were treated with DMSO (vehicle; 0.1% (v/v), the final concentration in all compound-treated cells), 100 nM pre-miR-155-Chem-CLIP or 100 nM control probe Ac-Chem-CLIP for 6 h. Competitive Chem-CLIP was performed by pretreating MDA-MB-231 cells with pre-miR-155-amide (0–1 μM as indicated) for 2 h followed by addition of pre-miR-155-Chem-CLIP (100 nM) and incubating the cells for 16 h.

JUN Chem-CLIP

MIA PaCa-2 cells, grown to about 90% confluency in 100-mm-diameter dishes, were treated with DMSO (vehicle), JUN-Chem-CLIP or Ctrl-Chem-CLIP at the indicated concentrations for 6 h. Competitive Chem-CLIP was performed by pretreating MIA PaCa-2 cells with JUN-binder at the indicated concentrations for 2 h followed by the addition of JUN-Chem-CLIP and incubating cells for another 5 h. After cross-linking and RNA isolation as described in the ‘General protocol for cellular Chem-CLIP’, the RNA samples were supplemented with a click reaction mixture consisting of disulfide biotin azide (Click Chemistry Tools, 1168, 0.5 µl, 100 mM), CuSO4 (1 µl, 10 mM), THPTA (1 µl, 50 mM) and sodium ascorbate (1 µl, 250 mM). The reaction was incubated at 37 °C for 3 h. After the incubation period, 100 µl of Streptavidin beads (Dynabeads MyOne Streptavidin C1 beads; Thermo Fisher Scientific) was added, and the samples were incubated at room temperature for 1 h. The washing and elution steps were identical to those described in the ‘General protocol for cellular Chem-CLIP’ section.

MYC Chem-CLIP

HeLa cells, grown to about 80% confluency in 60-mm-diameter dishes, were treated with vehicle, MYC-Chem-CLIP or control probe Ctrl-Chem-CLIP for 5 h. MYC competitive Chem-CLIP was performed by pretreating HeLa cells with MYC-binder at the indicated concentration for 2 h followed by addition of MYC-Chem-CLIP (10 μM) and incubating the cells for 5 h. The remaining steps were performed as described in the ‘General protocol for cellular Chem-CLIP’ section.

RT–qPCR analysis

General Protocol for RT–qPCR analysis

Total RNA was extracted using the Zymo Quick-RNA MiniPrep Kit according to the manufacturer’s protocol. For pri- and pre- miRNAs and mRNAs, RT was performed using 200 ng of RNA with a Qscript cDNA Synthesis Kit (QuantaBio). For mature miRNAs, the RT reaction was performed using 200 ng of RNA with the miScript II RT Kit in a total volume of 20 μl (Qiagen). Subsequent qPCR analysis (see Supplementary Table 2 for primer sequences and Supplementary Figs. 2–7 for primer validation) using Power SYBR Green Master Mix (Life Technologies) or a TaqMan assay and a Applied Biosystems QS5 384-well PCR system (software v.1.3.0). For mature miR-155 levels, TaqMan assays were performed using the ipu-miR-155 Taqman Assay (Thermo Fisher Scientific, 467534). Data were analysed using the ΔΔCt method as described previously13.

RT–qPCR analysis of mRNA and pri-, pre- and mature miRNA levels

MDA-MB-231 cells or MCF-10a cells were seeded in 12-well plates at around 60% confluency. Cells were treated with compound, LNA-155 miRCURY LNA Power Inhibitor (Qiagen; 5′UUAAUGCUAAUCGUGAUAGGGGU) or vehicle (0.1% (v/v) DMSO, the final concentration in all compound-treated samples) at the indicated concentrations for 48 h in growth medium (unless noted otherwise; Extended Data Fig. 6e). For washout experiments, MDA-MB-231 cells (around 40% confluency) were treated with pre-miR-155-RIBOTAC at the indicated concentration in growth medium for 48 h. After the treatment period, the cells were washed with 1× DPBS and fresh growth medium without the compound was added. Total RNA was then collected from the cells at the indicated timepoints after treatment (12, 24 and 36 h). For competitive experiments with the binder and the RIBOTAC, both compounds were added to the growth medium at the indicated concentrations, applied to the cells and incubated for 48 h. For miRNA profiling, cells were treated with pre-miR-155-RIBOTAC (100 nM) or LNA-155 (50 nM) in growth medium for 48 h.

CFPAC cells were seeded in 12-well plates at about 50% confluency and treated with compounds at the indicated concentrations for 48 h. HUVECs cells were seeded in 12-well plates at around 60% confluency and treated with compound prepared in growth medium at the indicated concentrations for 48 h. The competitive experiment with the binder and the RIBOTAC was performed by adding both compounds to the growth medium to the desired concentrations, applying the mixture to the cells and incubating for 48 h.

RT–qPCR analysis of JUN mRNA

MIA PaCa-2 cells, whether unmodified or CRISPR-modified cell lines, were grown to around 40% confluency in 12-well plates and then treated with vehicle (DMSO; 0.1% (v/v), the final concentration in all compound-treated samples) or compound in growth medium at the indicated concentration. The siRNA directed at JUN (Dharmacon; L-003268-00-0005) or a scrambled control siRNA (Dharmacon; D-001810-10-05) was transfected with Lipofectamine 3000 (Invitrogen, L3000001) according to the manufacturer’s instructions. After RT as described above, qPCR amplification was performed using the TaqMan gene expression assay (GAPDH: Hs03929097_g1, 4331182; JUN: Hs00277190_s1, 4331182) and the TaqMan Fast Advanced MasterMix. The same protocol was used for MIA PaCa-2 cells in which RNase L was knocked down by CRISPR and cells for which a control guide RNA was used.

RT–qPCR analysis of MYC mRNA

HeLa cells and MDA-MB-231 cells (whether unmodified or CRISPR-modified cell lines), grown to around 30% or 50% confluency in 12-well plates, respectively, were treated with vehicle (DMSO; 0.1% (v/v), the final concentration in all compound-treated samples) or compound of interest in growth medium for 24 h. After 24 h, the medium was removed, and the cells were treated with fresh medium containing compound for additional 24 h. For MYC siRNA studies, cells were seeded in 12-well plates and 1 nM of MYC siRNA (SantaCruz, sc-29226) or scrambled control (SantaCruz, sc-37007) was transfected with Lipofectamine 3000 according to the manufacturer’s recommended protocol. Namalwa (0.4 × 106 cells per ml, 2 ml), HL-60 (0.5 × 106 cells per ml, 2 ml) and Raji (0.7 × 106 cells per ml, 2 ml) cells were treated with vehicle, MYC-RIBOTAC or MYC-Ctr for 48 h. For Namalwa, HL-60 and Raji cells, RNase L mRNA levels were also measured using RT–qPCR. For studies performed in MCF-10a and MDA-MB-231 cells, TaqMan assays were also performed using the TaqMan gene expression assay (GAPDH: Hs03929097_g1, 4331182; MYC: Hs00153408_m1, 4331182) and the TaqMan Fast Advanced MasterMix.

RT–qPCR analysis of MYC IRES-luciferase mRNA

HEK293T cells were transfected and treated as described in the ‘MYC luciferase reporter assay’ section except in 12-well instead of 96-well plates. After 48 h, the total RNA was extracted and RT–qPCR was performed as described for mRNAs in the ‘General protocol for RT–qPCR analysis’ section.

Western blot analysis

General protocol for western blotting

After treatment as specified for each target below, total protein was collected using M-PER Extraction Reagent (Thermo Fisher Scientific), and protein concentration was measured using the Pierce Micro BCA Protein Assay Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol. Approximately 20 μg of total protein, except for analysis of SOCS1 protein (which used 40 μg due to its low abundance), was resolved on a 10% SDS–polyacrylamide gel. After transferring to a PVDF membrane and blocking the membrane with 1× tris-buffered saline supplemented with 0.1% (v/v) Tween-20 (TBST; 50 mM Tris-Cl, pH 7.5, 150 mM NaCl and 0.1% (v/v) Tween-20) with 5% (w/v) milk, the membrane was incubated with the primary antibody (see below for each target) in 1× TBST with 5% (w/v) milk at 4 °C for 16 h. The membrane was washed three times with 1× TBST (5 min per wash) at room temperature. The blot was then incubated with IgG horseradish-peroxidase (HRP) secondary antibody conjugate in 1× TBST with 5% milk at room temperature for 1 h. After washing five times with 1× TBST (5 min per wash), the target protein was detected by using SuperSignal West Pico Chemiluminescent Substrate (Pierce Biotechnology) and quantified using ImageJ. The membrane was then stripped (200 mM glycine, pH 2.2, 4 mM SDS, 1% (v/v) Tween-20) at room temperature for 30 min and blotted again with either β-actin or GAPDH for normalization.

Western blot analysis of SOCS1

MDA-MB-231 cells were seeded in six-well plates at about 60% confluency and treated with pre-miR-155-RIBOTAC at the indicated concentrations for 48 h. The anti-SOCS1 primary antibody (Cell Signaling Technology (CST), 3950S) was used at 1:2,500 dilution followed by anti-rabbit IgG-HRP secondary antibody conjugate (CST, 7074S) at 1:5,000 dilution. After stripping, β-actin primary antibody (CST, 3700S) was used at 1:5,000 dilution, followed by anti-mouse IgG HRP secondary antibody conjugate (CST, 7076S) at 1:10,000 dilution.

Western blot analysis of VHL

HUVECs (around 60% confluency) were seeded in six-well plates and treated with pre-miR-155-RIBOTAC at the indicated concentration for 48 h. The anti-VHL primary antibody (CST, 68547S) was used at 1:1,000 dilution followed by anti-rabbit IgG HRP (CST, 7074S) at 1:5,000 dilution. β-Actin was detected as described above in the ‘Western blot analysis of SOCS1’ section.

Western blot analysis of JUN and RNase L

MIA PaCa-2 cells were seeded in six-well plates and treated with vehicle (0.1% (v/v) DMSO; the final concentration in all compound-treated samples) or compound at the indicated concentrations in growth medium for 72 h once they reached around 40% confluency. The anti-JUN primary antibody (CST, 9165S) or anti-RNase L antibody (CST, D4B4J) was used at 1:1,000 dilution followed by anti-rabbit IgG HRP (CST, 7074S) at 1:10,000 dilution. β-Actin was detected as described above in the ‘Western blot analysis of SOCS1’ section.

Western blot analysis of MYC

HeLa cells in six-well plates (around 30% confluency) or MDA-MB-231 cells (about 60% confluency) were seeded in six-well plates and treated with vehicle or compound at the indicated concentrations in growth medium for 24 h. The compound-containing growth medium was removed and replaced with fresh growth medium containing compound. The cells were incubated for an additional 24 h at which point total protein was collected as described above. Namalwa cells (0.4 × 106 cells per ml, 10 ml) were treated with vehicle, MYC-RIBOTAC or MYC-Ctr for 48 h (single dose), and then total protein was collected. The anti-MYC antibody (CST, 5605S) was used at 1:1,000 dilution followed by anti-rabbit IgG HRP (CST, 7074S) at 1:5,000 dilution. The anti-GAPDH primary antibody (CST, 51332S) was used at 1:3,000 dilution followed by direct imaging (no secondary antibody needed as this antibody is an HRP conjugate). The membrane was not stripped and was directly blotted with anti-GAPDH antibodies for normalization.

Western blot analysis of BRD4

The same procedure was followed as described in the ‘Western blot analysis of MYC’ section except that the primary antibody was anti-BRD4 (Cell Signaling Technologies, 13440S) at 1:1,000 dilution. The effect of MZ1 on BRD4 and MYC protein levels was validated and shown in Supplementary Fig. 8.

SOCS1 luciferase reporter assay (pre-miR-155)

HEK293T cells in 60-mm-diameter dishes (around 80% confluency) were co-transfected with 4 µg of a plasmid encoding SOCS1 fused to luciferase (Genecopoeia, HmiT021399-MT06) and 1 µg of the plasmid expressing wild-type pre-miR-155 using jetPRIME (Polypuls, 101000027) according to the manufacturer’s recommended protocol. The cells were seeded to 96-well plates (7,000 cells per well) after transfection. After incubating for 12 h, the cells were treated with DMSO (vehicle, 0.1% (v/v)) or pre-miR-155-RIBOTAC. A dose–response was measured by treating pre-miR-155-RIBOTAC at 0, 10 and 100 nM for 48 h and a time course was measured by treating pre-miR-155-RIBOTAC (100 nM) for 6, 24, 48 and 72 h. The Dual-Glo Luciferase Assay System (Promega, E2920) was used to measure luciferase activity, according to the manufacturer’s instructions.

MYC luciferase reporter assay

The MYC IRES luciferase plasmid was custom-synthesized by GenScript (U6617GC310) by inserting the MYC IRES sequence between the two Click Beetle luciferases (CBR and CBG) within the pcDNA5 vector. HEK293T cells in 60-mm-diameter dishes (around 80% confluency) were co-transfected with 2 µg of a plasmid and 500 ng of a plasmid expressing Renilla luciferase (normalization) using jetPRIME (Polyplus, 101000027) according to the manufacturer’s recommended protocol. Control experiments were performed by co-transfecting 2 µg of a plasmid encoding luciferase lacking the IRES (GenScript) and 500 ng of a plasmid expressing Renilla luciferase (for normalization). The cells were trypsinized and seeded into 96-well plates (7,000 cells per well). After incubating for 12 h, the cells were treated with vehicle or MYC-RIBOTAC (10 µM) for the indicated time. Click Beetle (which uses the same substrate as firefly luciferase) and Renilla luciferase activities were measured using the Dual-Glo Luciferase Assay System (Promega, E2920) according to the manufacturer’s instructions.

To construct a mutant MYC IRES plasmid in which the small-molecule-binding motif was mutated into base pairs, the Q5 Site-Directed Mutagenesis Kit (NEB, E0554S) was used according to the manufacturer’s recommendations. The primers used to create the mutant were: 5′CGCCTCTGGCGAAGCCCTCCCG and 5′AAGCCCCCTATTCGCTCC (IDT), where the bold nucleotide indicates the point mutation. The mutagenesis product was transformed into chemically competent Escherichia coli (included in the kit) and selected using ampicillin-agar plates. The mutant plasmid sequence was confirmed by Sanger sequencing, and the plasmid was tested in HeLa cells according to the same procedure as described above.

Methylcellulose colony assays

Namalwa Burkitt lymphoma cells (1,000 cells per ml, 3 ml) were treated with MYC-Ctr (10 µM) or MYC-RIBOTAC (10 µM) for 48 h (single dose). The cells were then collected by centrifugation for 5 min at 1,000 rpm, and 1 × 103 viable cells were resuspended in 400 µl of IMDM medium containing 2% (v/v) FBS. The cells were then added to 4 ml of Methocult (STEMCELL Technology, H4230), and 1.1 ml was carefully spread into a SmartDish (STEMCELL Technology, 27370). Cells were incubated for 7–10 days, and colonies were counted manually.

Cell cycle analysis

Namalwa (0.4 × 106 cells per ml, 2 ml), HL-60 (0.5 × 106 cells per ml, 2 ml) and Raji (0.7 × 106 cells per ml, 2 ml) cells were treated with vehicle, MYC-RIBOTAC (10 µM) or MYC-Ctr (10 µM) for 48 h (single dose). To assess the percentage of cells at each stage of the cell cycle, 1 × 106 cells were fixed dropwise with 70% (v/v) ethanol at room temperature, and then stored for 24 h at −20 °C. Fixed cells were washed twice with 1× PBS, and then treated with 50 µl of 100 µg ml−1 RNase A (Sigma-Aldrich, R-6148) for 5 min room temperature. The cells were then stained with 200 µl of 50 µg ml−1 propidium iodide; Sigma-Aldrich, P4170) prepared in 1× PBS. The stained cells were analysed for the percentage in the G1, S and G2 phases of the cell cycle in a BD LSRII (BD Biosciences) flow cytometer. Cell doublets were excluded from analysis.

Drug metabolism and pharmacokinetic studies (pre-miR-155)

Female C57Bl/6 mice (n = 3) were treated once with either pre-miR-155-RIBOTAC or pre-miR-155-amide-binder at 1 mg per kg (10:10:80 of DMSO:Tween-80:H2O) by i.p. injection. The plasma was then collected at 0, 15, 30, 60, 120, 240, 360, 480 and 1,440 min to determine the concentration in plasma.

In vivo studies to assess lung colonization of breast cancer cells (pre-miR-155)

Mice were housed in individually ventilated (IVC), JAG 75 cages with micro-isolator lids. HEPA filtered air was supplied into each cage at a rate of 60 air exchanges per h. The dark–light cycle was set for 08:00 (on)–20:00 (off). The temperature was maintained at 72 ± 2 °F (22.2 ± 1.1 °C). Humidity was maintained at 30–70%. Female NOD/SCID mice (n = 8 per group; 5–7 weeks; The Jackson Laboratory) were used for breast cancer studies as described previously56, and all studies were approved by The Scripps Research Institute IACUC (protocol no. 16-025). The maximal tumour size allowable under this protocol is 500 mm3 or 2 cm in diameter.

In brief, mice were intravenously injected (tail vein) with MDA-MB-231-Luc cells (0.8 × 106 cells per mouse). Compound treatment began 5 days later as determined by luciferase activity, where the averaged luciferase signal in the lung tissue is ten times higher than background measured from neighbouring tissues. Luciferase activity was measured by i.v. injection of luciferin (150 mg per kg) every other day as measured by LagoX (Spectral Instruments). Mice were split into two groups: vehicle group (10:10:80 of DMSO:Tween-80:H2O) or 1 mg per kg of either pre-miR-155-RIBOTAC or pre-miR-155-amide in the same formulation. Compound or vehicle was delivered by i.p. injection every other day.

After 30 days, mice were euthanized by affixiation with CO2 in accordance with guidelines provided by the American Veterinarian Medical Association. For each group, the lungs from five mice were perfused with 1× PBS, collected and immediately fixed in Bouin’s solution (Sigma-Aldrich, HT10132-1L) to image nodules. After imaging, the lungs were sectioned and stained with H&E staining or analysed using FISH to assess pre-miR-155 levels. The FISH probe and qPCR primers are specific to human mature and pre-miR-155; mouse pre-miR-155 has a different secondary structure lacking the binding site for pre-miR-155-RIBOTAC. Human and mouse SOCS1 protein cannot be distinguished by available antibodies; therefore, SOCS1 protein levels were not determined. For the remaining three mice from each group, the lungs were collected and snap-frozen for extracting total RNA to measure mature-miR-155 levels by RT–qPCR.

To image lung nodules, lungs were fixed in 60 ml of Bouin’s solution for 24 h followed by briefly rinsing in 10% neutral buffered formalin solution (Harleco). After counting nodules, the lungs were washed with 60 ml of 10% (v/v) formalin solution four times (8 h per wash with gentle shaking at room temperature). Paraffin-embedded sections were generated by the Histology Core at The Scripps Research Institute using a Sakura Tissue-Tek VIP5 paraffin processor. H&E staining was performed on the Leica ST5010 Auto-Stainer XL at The Scripps Research Institute’s Histology Core.

For FISH analysis to assess mature miR-155 levels, the sections were incubated at 60 °C for 15 min followed by deparaffination with xylene. The sections were rinsed once in each of the following solutions: 95%, 80%, 50% and 0% ethanol in water. The sections were then treated with 20 µg ml−1 proteinase K in 50 mM Tris, pH 7.5, for 10–20 min at 37 °C, followed by rinsing in water five times. The sections were then treated with ice-cold 20% (v/v) acetic acid for 20 s to permeabilize cells, followed by rinsing with Nanopure water three times. The sections were dehydrated by rinsing in 100% ethanol. The sections were then prepared for FISH analysis by rinsing the sections in 40% formamide/2× SSC (0.3 M sodium chloride and 0.03 M sodium citrate, pH 7.0) buffer for 5 min. The slides were then incubated with 40% formamide/2× SSC buffer containing 0.2 µM FITC-labelled DNA probe (5′-AACCCCTATCACGATTAGCATTAA), 2 µg ml−1 BSA, 10 nM tRNA (Roche, 10109517001) in a humidified chamber at 37 °C for 16 h. The slides were then rinsed three times with 2× SSC, and once with 1× DPBS, followed by addition of an anti-FITC antibody (Abcam, 6656; 1:500 dilution in 1×TBST buffer containing 1% (v/v) goat serum (Sigma-Aldrich)). After incubation at room temperature for 2 h, the slides were rinsed three times with 1× DPBS and visualized using a DAB Substrate Kit (Abcam, 64238) according to the manufacturer’s protocol. Images were acquired using a bright-field microscope (Leica DM800) and quantified using ImageJ.

The lungs from the other three mice were frozen at −80 °C and homogenized using tissue plastic homogenizing probes (Omni International, 10062-782). The RNA extraction and RT–qPCR analysis were performed the same as described above in the ‘RT–qPCR analysis of mRNAs and pri-, pre- and mature miRNA levels’ section.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.